Questions on the manipulation of String objects in Mathematica, and the functions used for these manipulations.

learn more… | top users | synonyms (4)

3
votes
1answer
18 views

help with string patterns and RemoveCellTags

I am building a table of contents using AuthorTools. I used it to create cell tags so the TOC can make hyperlinks, but then I decided I wanted to change them. But I am having trouble removing the ...
0
votes
1answer
63 views

How to convert this .txt data into a list of points [on hold]

Question How to import data from a .txt file into Mathematica and convert it to an expression? Download the .txt file here (click download): http://pastebin.com/2NW2DfiE
2
votes
1answer
36 views

read Python-generated data file

I've read similar-but-not-quite-the-same questions : I have to read a python-generated data file which contains complex numbers. So, the numbers appear as (real+imag j). And of course Mathematica ...
2
votes
2answers
132 views

Manipulating strings containing backslash

I'm trying to implement some code that downloads files from some webpages. I am using the built-in functions Import and ...
3
votes
2answers
56 views

Abbreviated expressions in StringCases? [duplicate]

Am I missing something here? There's no support for abbreviated expressions in StringCases? StringMatchQ["MATCH", "*H"] (* ...
5
votes
1answer
68 views

What are “\<” and “\>” delimiters in box expressions?

If I enter a string (say, "abc") in a cell, and then switch to box representation (Shift+Ctrl+E or menu item ...
5
votes
3answers
156 views

Can StringTemplate be extended to offer printf-like formatting capabilities?

Apparently, Mathematica has no real sprintf-equivalent (unlike any other high-level language known to man). This has been asked before, but I'm wondering if the new ...
6
votes
2answers
210 views

How to I extract the element name of a chemical compound in a string?

Say I have a compound Fe3O4, and I want to separate the name of elements and number. The code I write for separate number is ...
5
votes
1answer
118 views

Why Base64 ends with a newline? (\n)

Why everything converted to Base64 has a newline at the end? It isn't one of base characters, is it? ...
1
vote
1answer
31 views

Oddity with ToExpression [duplicate]

Is this a bug? ToExpression["3231.432"] 3231.43 I would have expected the following: 3231.432 I am using Mathematica 10.2.0
3
votes
1answer
59 views

How to collect elements in one list with the constraints provided in a second list

I wish to collect the items in the first list provided the constraints in the second list. For example in the lists shown below the first list shows a bunch of strings and the second list shows the ...
15
votes
3answers
403 views

Highlighting pattern strings in a large text

I would like to apply Style to strings that are matched, for example, with one or more specified patterns or regular expressions, a string or a list of both, ...
1
vote
2answers
80 views

Void elements / self closing tags export to HTML

There are some built in rules in exporting that automatically create Void elements / self closing tags for some tags: ...
2
votes
2answers
48 views

Remove an element of a list [duplicate]

I want to check if any element of a list contains Missing["NotAvailable"] If so I want to delete the entire list. If I am correct I need to have some ...
6
votes
1answer
129 views

String replacement in a large text file

I have to replace a string, let's say "ABC" to "XYZ", in a huge plain text file (10 Gb and above). Obviously, the ...
21
votes
8answers
3k views

How to express an integer number in English words?

How do I convert a number to a readable string? I would like to implement a function, inWords[], inWords[n_]:= ? which ...
4
votes
2answers
94 views

Unescape Formatting in Strings [closed]

Mathematica has a dirty habit of sometimes escaping all the formatting in my strings when loading a .nb. I know this is inevitable for ...
3
votes
1answer
68 views

Wrapping long strings at word breaks

My code (PostScriptForm) returns a long string, about 7k characters, in which there are eight deliberate “\r\n” ‘paragraph’ breaks. Copying the long string into a ...
3
votes
2answers
156 views

Replacing doubled letter with that letter plus a code

I want to replace the second occurrence of a letter in a double letter pair with a specified code. For example, if the code is a capital letter "X", then the input ...
3
votes
0answers
295 views

Negative power instead of fraction [duplicate]

Solve returns a solution in the form {{ x -> y / a^2 + y^2 / a^7 }}. Since I want to process the input (with another program) in terms of Laurent polynomials, I ...
3
votes
1answer
81 views

How to use `Shortest` for pattern matching? [duplicate]

For the string ((!@#)), the shortest match for the pattern "("~~__~~")" should be "(!@#)", ...
7
votes
1answer
131 views

How to take all sub-strings in a string that are combinations of specified characters only

"tgtaaaaacaagaaaaacatggaatgtataatactataaataaaaaaagtaggaagaagaaccaaaaca\ aagggcgttttaaagagagacgaat" based on the above string (a DNA sequence) I wish to extract ...
0
votes
3answers
89 views

Parsing, StringReplace and token priority

Although I was slightly taken aback when I came across the behaviour, the following examples are perfectly in line with the way StringReplace is described in the ...
1
vote
0answers
118 views

Read in bezier curve from svg file

I am trying to do some calculation of some svg file,After read in with Import["filename","XML"]and some easy operation, I can get the string of the bezier curve, ...
0
votes
3answers
63 views

Importing Text file with Null Character column separation

I have a text file (ANSI econding) with two columns of real numbers separated, unfortunately, by a "Null Character" ("\.00"). How can I import this data easily? ...
3
votes
1answer
27 views

Entering null characters in a string

This question is about parsing files that contain nulls (character code zero) as field separators. Intending to attempt to answer this I began by trying to enter a string containing a null, e.g. by ...
6
votes
4answers
593 views

How to replace a space by a comma

in this expression = "{1 2 3 4 5 6 7 8}", I want to replace each space by a comma , to get ...
0
votes
1answer
65 views

Stringifying $GeoLocation for the browser

Currently, when I ask for ExportString[{"geoLocation"->TextString[$GeoLocation]},"JSON", "Compact"->True] I get this: ...
6
votes
1answer
123 views

Finding quotations in a text

I actually deal with the problem of finding quotations (i.e. "this is a quotation") in larger texts of different languages, mostly German and English. Unfortunately there are several ways to fill text ...
3
votes
5answers
80 views

Insert or Remove randomly

I have a series of characters such as "ABCVABVCCAVB". I wish to randomly remove or insert character. I could make to remove case like deleting all A, or B,... but I wish to remove or insert only 1 ...
19
votes
4answers
407 views

Unexpected result {“.a”, “co”, “.m”} from Sort[{“.m”, “.a”, “co”}]

I came across the following situation: Evaluating Sort[{".m", ".a", "co"}] Results in {".a", "co", ".m"} I wondering: ...
3
votes
6answers
253 views

Joining strings in every third element in a list

How do I join a string to the first and every third element in the list? Example: list={1,2,3,4,5,6,7,8,9..} ={"string1",2,3,"string4",5,6,"string7",8,9..} I ...
0
votes
0answers
31 views

Printing the name of variable in a list as a string [duplicate]

I have a list of objects MyList = {OII,IOI,OIO} where every object is a vector (the names are for ease of use, since they stand for 011, 101, 010). For example ...
10
votes
5answers
226 views

Backquote in string template?

I need to have backquotes in a StringTemplate. For example StringTemplate["``1``"][2] Returns ...
1
vote
1answer
39 views

How to add a `Style` string or `Hyperlink` in CloudDeploy?

There are two wrong code like this: The first problem is I want to put the red string to Title. ...
2
votes
1answer
31 views

Evaluation of BlankNullSequence inside StringReplace

I would like to replace the occurrence of "a(x)" and "b(x)" in a list with "a(x-na)" and ...
3
votes
1answer
61 views

How to change the word's color in string

The picture I load is my target: This is my code in mathematica ...
7
votes
3answers
133 views

How can I know if a pattern corresponds to a string pattern?

What would be the best way to detect if a pattern corresponds to a string pattern ? An invalid string pattern p would lead to an error in ...
1
vote
0answers
45 views

String Question [closed]

Consider: listOfScores = Import["http://www.handsonstart.com/ExampleDataScores.txt", "Data"] Which gives this output: ...
1
vote
1answer
42 views

Difference between `StringJoin` and `StringExpression`

When does one need StringJoin as opposed to StringExpression? I don't know of an example where ...
1
vote
1answer
36 views

Extract pattern from `StringExpression` [closed]

I want to extract a string that is book-ended by two strings. For example, given <em> This is emphasized </em>, I can find the whole string using a ...
29
votes
6answers
844 views

Partition string into chunks

This seems like it should be trivial, but how do I partition a string into length n substrings? I can of course write something like ...
6
votes
3answers
121 views

Grouping words by their differences

I'm a new guy here and I face a problem. I should pair the following words according to the rule: pair the words, that differ by max. 2 characters, like: ...
2
votes
3answers
56 views

Cardinality of members of a list [closed]

I have to count all the words in a book. I need the cardinality (occurrence) of all the words. {{Table,30},{the,200},{apple29}, etc... I Splitted, and StringTrimed ...
0
votes
1answer
31 views

add " for all member of the last (1 and -1 positions)

I have a small problem with a list. I did, that list={AA,BB,CC} and I wish to make it into the form of {"AA","BB","CC"}, but I cant insert ", because failing, I tried simply adding, or MapThreading, ...
1
vote
0answers
40 views

Where can I find documentation on use of special characters in templates?

I am new to Templates. I have seen the usage "\!\(\*StyleBox ...)" as here: disabling templates What does the string "!(*" accomplish and can I find some ...
3
votes
1answer
61 views

StringReverse question

I was thinking about how to make this with the StringReverse, but I failed: I have a sequence of (for example) "FDSRTYNHFNKHLIUHG", I wish to reverse, but randomly long sequence reversed from a ...
5
votes
5answers
419 views

Random character change in a random place

I would like to ask for help in a Random Replace of character. For example: ORANGE and change 1 character randomly (random place and random character from ORANGE) in it into any character of ORANGE, ...
2
votes
2answers
79 views

German Umlaut: how to forward through Run to the say command on OS X?

My aim is to make Mathematica speak out German words with Umlauts. I found a hint how to make use of a help function mySpeak that will forward a string to the say command and set the corresponding ...