Questions on the manipulation of String objects in Mathematica, and the functions used for these manipulations.

learn more… | top users | synonyms (5)

3
votes
0answers
296 views

Negative power instead of fraction [duplicate]

Solve returns a solution in the form {{ x -> y / a^2 + y^2 / a^7 }}. Since I want to process the input (with another program) in terms of Laurent polynomials, I ...
3
votes
1answer
91 views

How to use `Shortest` for pattern matching? [duplicate]

For the string ((!@#)), the shortest match for the pattern "("~~__~~")" should be "(!@#)", ...
8
votes
1answer
142 views

How to take all sub-strings in a string that are combinations of specified characters only

"tgtaaaaacaagaaaaacatggaatgtataatactataaataaaaaaagtaggaagaagaaccaaaaca\ aagggcgttttaaagagagacgaat" based on the above string (a DNA sequence) I wish to extract ...
0
votes
3answers
99 views

Parsing, StringReplace and token priority

Although I was slightly taken aback when I came across the behaviour, the following examples are perfectly in line with the way StringReplace is described in the ...
2
votes
0answers
131 views

Read in bezier curve from svg file

I am trying to do some calculation of some svg file,After read in with Import["filename","XML"]and some easy operation, I can get the string of the bezier curve, ...
0
votes
3answers
84 views

Importing Text file with Null Character column separation

I have a text file (ANSI econding) with two columns of real numbers separated, unfortunately, by a "Null Character" ("\.00"). How can I import this data easily? ...
3
votes
1answer
45 views

Entering null characters in a string

This question is about parsing files that contain nulls (character code zero) as field separators. Intending to attempt to answer this I began by trying to enter a string containing a null, e.g. by ...
0
votes
1answer
79 views

Stringifying $GeoLocation for the browser

Currently, when I ask for ExportString[{"geoLocation"->TextString[$GeoLocation]},"JSON", "Compact"->True] I get this: ...
6
votes
1answer
126 views

Finding quotations in a text

I actually deal with the problem of finding quotations (i.e. "this is a quotation") in larger texts of different languages, mostly German and English. Unfortunately there are several ways to fill text ...
3
votes
5answers
86 views

Insert or Remove randomly

I have a series of characters such as "ABCVABVCCAVB". I wish to randomly remove or insert character. I could make to remove case like deleting all A, or B,... but I wish to remove or insert only 1 ...
20
votes
4answers
423 views

Unexpected result {“.a”, “co”, “.m”} from Sort[{“.m”, “.a”, “co”}]

I came across the following situation: Evaluating Sort[{".m", ".a", "co"}] Results in {".a", "co", ".m"} I wondering: ...
3
votes
6answers
264 views

Joining strings in every third element in a list

How do I join a string to the first and every third element in the list? Example: list={1,2,3,4,5,6,7,8,9..} ={"string1",2,3,"string4",5,6,"string7",8,9..} I ...
0
votes
0answers
32 views

Printing the name of variable in a list as a string [duplicate]

I have a list of objects MyList = {OII,IOI,OIO} where every object is a vector (the names are for ease of use, since they stand for 011, 101, 010). For example ...
10
votes
5answers
259 views

Backquote in string template?

I need to have backquotes in a StringTemplate. For example StringTemplate["``1``"][2] Returns ...
1
vote
1answer
68 views

How to add a `Style` string or `Hyperlink` in CloudDeploy?

There are two wrong code like this: The first problem is I want to put the red string to Title. ...
2
votes
1answer
35 views

Evaluation of BlankNullSequence inside StringReplace

I would like to replace the occurrence of "a(x)" and "b(x)" in a list with "a(x-na)" and <...
3
votes
1answer
72 views

How to change the word's color in string

The picture I load is my target: This is my code in mathematica ...
7
votes
3answers
134 views

How can I know if a pattern corresponds to a string pattern?

What would be the best way to detect if a pattern corresponds to a string pattern ? An invalid string pattern p would lead to an error in ...
1
vote
0answers
51 views

String Question [closed]

Consider: listOfScores = Import["http://www.handsonstart.com/ExampleDataScores.txt", "Data"] Which gives this output: ...
1
vote
1answer
49 views

Difference between `StringJoin` and `StringExpression`

When does one need StringJoin as opposed to StringExpression? I don't know of an example where ...
1
vote
1answer
49 views

Extract pattern from `StringExpression` [closed]

I want to extract a string that is book-ended by two strings. For example, given <em> This is emphasized </em>, I can find the whole string using a <...
29
votes
6answers
901 views

Partition string into chunks

This seems like it should be trivial, but how do I partition a string into length n substrings? I can of course write something like ...
6
votes
3answers
132 views

Grouping words by their differences

I'm a new guy here and I face a problem. I should pair the following words according to the rule: pair the words, that differ by max. 2 characters, like: ...
2
votes
3answers
64 views

Cardinality of members of a list [closed]

I have to count all the words in a book. I need the cardinality (occurrence) of all the words. {{Table,30},{the,200},{apple29}, etc... I Splitted, and StringTrimed ...
0
votes
1answer
31 views

add " for all member of the last (1 and -1 positions)

I have a small problem with a list. I did, that list={AA,BB,CC} and I wish to make it into the form of {"AA","BB","CC"}, but I cant insert ", because failing, I tried simply adding, or MapThreading, ...
1
vote
0answers
46 views

Where can I find documentation on use of special characters in templates?

I am new to Templates. I have seen the usage "\!\(\*StyleBox ...)" as here: disabling templates What does the string "!(*" accomplish and can I find some ...
3
votes
1answer
62 views

StringReverse question

I was thinking about how to make this with the StringReverse, but I failed: I have a sequence of (for example) "FDSRTYNHFNKHLIUHG", I wish to reverse, but randomly long sequence reversed from a ...
5
votes
5answers
446 views

Random character change in a random place

I would like to ask for help in a Random Replace of character. For example: ORANGE and change 1 character randomly (random place and random character from ORANGE) in it into any character of ORANGE, ...
3
votes
2answers
87 views

German Umlaut: how to forward through Run to the say command on OS X?

My aim is to make Mathematica speak out German words with Umlauts. I found a hint how to make use of a help function mySpeak that will forward a string to the say command and set the corresponding ...
1
vote
5answers
397 views

How to repeat a string?

I really can't find a way how to multiply (repeat) strings in Mathematica. How to write this shorter? ...
3
votes
1answer
89 views

How to extract “this text” between specific characters: 1) this text 1)

I have a text file that has thousands of questions and blanks for the answer, like this: 1) This is the first question 1)______ 2) This is the second question 2)______ 3)... What I ...
2
votes
1answer
44 views

Select date and time using string case

I did the following code to get data from a list: Partition[Flatten[StringCases[Flatten[del2], {__ ~~ ":" ~~ _ ~~ ($1___) ..} -> { $1}, Infinity], 2], 23] ...
3
votes
1answer
65 views

Prevent expression from evaluation in function when using `ToString `

I defined function fhold Clear[fhold] SetAttributes[fhold, HoldAll] fhold[para_List] := ToString[para]; What I want is that ...
4
votes
1answer
135 views

Permute list of strings

Say I have a list of strings like slist={"apple","123","Car"} What I want is a list of all permutations of slist. The result ...
2
votes
1answer
60 views

Using strings in defining rules

I am very new using Mathematica and I would like to define a rule of replacement which operates as below, keeping freedom for what concern the pre-factors that can appear in the equation: $$e^{\pm ix} ...
5
votes
5answers
638 views

Joining some strings in a list of strings

So, say I have a list of strings, representing lines in a file, like so: ...
2
votes
2answers
99 views

How to transform data in character form into a sensible form?

I have a data output from a device in a form of a string. I need to transform it into such a form that I can work with it, such as plot columns with respect to one another and such. After a apply <...
2
votes
1answer
232 views

Replace punctuation marks in strings with spaces

I have a list of strings. Some of them contain commas, single quotes, etc. Is there a quick way to replace those characters by blanks? My list looks something like this: ...
3
votes
2answers
105 views

How remove specified substring and everything after it to the end of a string?

If I have, say, the string, txt = "now is the time for all (good) men" then I want to remove the substring beginning with "for" and ending at the end of the ...
5
votes
0answers
58 views

SimilarityRules for SequenceAlignment of two lists

I am trying to use the SimilarityRules option of SequenceAlignment to customize its output. This works perfectly for strings, ...
0
votes
1answer
38 views

Regular expression help for arecord command output

How do I get the card number and device number alone from this string by using a regular expression to parse it? Here's the string ...
3
votes
0answers
50 views

Why was StringRepeat designed so that StringRepeat[s, 0] throws an error?

I'm wondering about the rationale behind the design decision that leads to the following expression throwing an error: ...
8
votes
2answers
307 views

How can I use words/letters as pixels in an image?

I'd like to take the text of a novel or whatever and arrange it in a way that forms an image. Essentially recreating these works from Postertext. . I'm mostly looking for ideas regarding a ...
3
votes
1answer
69 views

Whitespace is lost during MathML -> XMLElement conversion

ImportString["<mtext> </mtext>", {"MathML", "XMLElement"} ] XMLElement["mtext",{},{}] while I'd expect: <...
0
votes
1answer
82 views

How to implement the for loop to replace text strings or texts?

I wonder define a bunch variables named like $X_1$, $X_2$, $...$, $X_n$. Is there some smart way to declare them instead of by pure typing. One trick I can image is to use the for loop,...
0
votes
2answers
140 views

How to make an Histogram where the data are strings? [duplicate]

Histogram[{3, 3, 2, 2, 2, 2, 2, 1, 1}] works great to give you an histogram in which mathematica counts the occurence of each number and makes the plot. Is there a ...
15
votes
1answer
231 views

Mma 10.2 `Alphabet` and `LanguageData` give different and both erroneous list of letters

Bug introduced in 10.2 and fixed in 10.3 The new function Alphabet introduced in Mathematica 10.2 gives the wrong list of letters for the Spanish language in my ...
2
votes
2answers
233 views

What's wrong with my palindrome finding function?

I'm trying to find the palindromes in the dictionary, but my output isn't giving me all of them. I have this so far ...
2
votes
0answers
34 views

How can I construct a string pattern from a list of patterns? [duplicate]

Is it possible to construct a string pattern from a list of strings? ...
2
votes
1answer
59 views

Braces in pattern with Cases function

Here's my problem: I've got a JSON-formatted response and want to match some variables over the response. I'm doing it using Cases: ...