Questions on expression testing and manipulation through pattern matching and constructing efficient patterns.

learn more… | top users | synonyms (1)

0
votes
4answers
101 views

How to use Select according to a list of criteria to produce a list of subsets of another list obeying those criteria

The code Print[Select[{1, 4, 3, 9}, Mod[#, 3] == 0 &]]; Print[Select[{1, 4, 3, 9}, Mod[#, 3] == 1 &]]; Print[Select[{1, 4, 3, 9}, Mod[#, 3] == 2 &]] ...
9
votes
4answers
255 views

Pattern match for nested Association

Suppose I have Association testAssoc=Association[a->Association[1->1,2->2],b->Association[1->1,2->2]] which ...
0
votes
1answer
77 views

Pattern matching using Cases: why does this fail? [closed]

I have objects that look like, for example: F2 = 2 d[x] ^ d[y] + 3 d[x] ^ d[z] where ^ is ...
13
votes
2answers
304 views

Named patterns in Except

Bug introduced in 8 or earlier and fixed in 10.4.0 Bug isn't present in version 5.2 I don't think I quite understand how Except works. I want to define $f(a,b) ...
19
votes
1answer
258 views

Version inconsistency with optional arguments: what if the default value doesn't match the pattern?

I just came across some weird behaviour. Take this function definition: ClearAll[f] f[vs_List : All] := "match" The default value of ...
15
votes
2answers
189 views

Unexpected behaviour when pattern matching with Longest

I came across some unexpected behaviour today when using the Longest function when trying to do some pattern matching. ...
7
votes
1answer
85 views

Why can't I replace I with HoldPattern@I?

Just try this sample: I /. HoldPattern@I -> a (* I *) Why does it fail to replace I with ...
3
votes
0answers
59 views
4
votes
1answer
107 views

Trim a list of elements [closed]

I suppose this is a trivial question to many of you, please bear with me. I have a long list of words, list1. I would like to "remove all words that contain a specific letter, say "o". ...
4
votes
2answers
199 views

Replacing numbers of which you only know certain digits

If I have a list of numbers like this: list = {0.3565127, 0.8656421, 0.231479879, 0.39698787, 0.536987651}, which are all between 0 and 1, each having lots of ...
19
votes
1answer
257 views

What is the difference between defining a function and specifying the type of argument, versus applying a test to that argument?

Say I want to create a function that evaluates differently based on what type of argument is given. I've found two ways of doing this, ...
13
votes
6answers
904 views

Calling Table with custom iterator

I often find myself in situations where I, for example, need to build a table for some expression, but want to set the number of points rather then the step size, so the code ends up looking like this ...
4
votes
1answer
38 views

help with string patterns and RemoveCellTags

I am building a table of contents using AuthorTools. I used it to create cell tags so the TOC can make hyperlinks, but then I decided I wanted to change them. But I am having trouble removing the ...
1
vote
0answers
78 views

Pattern for a function of say 2 variables [closed]

How can I specify a pattern for an expression f for which say f[x,y] returns a value, ie is defined as a function taking two ...
2
votes
1answer
146 views

Why is there a difference when formulating patterns for Select and FirstPosition?

Select[{1, 2, 4, 7, 6, 2}, # > 2 &] Gives {4, 7, 6}. OK! So one should think that the following would work: ...
7
votes
2answers
292 views

Why doesn't this pattern work?

I want the in-built function Count to count the elements in a list which are greater than a value. Example: ...
7
votes
2answers
146 views

How to define patterns to filter lists of replacement rules?

I have a list of replacement rules like list˘of˘replacement˘rules = {a -> 1, b -> 2, c -> 3} and I want to filter all the elements where ‘b’ is replaced ...
2
votes
0answers
59 views

Pattern Matching and overloading NonCommutativeMultiply [duplicate]

My goal right now is to implement some rules like linearity etc for noncommuting operators (arbitrary matrices etc). This is partly an exercise for me to understand MMA better so giving me a package ...
11
votes
4answers
191 views

Evaluation of Alternatives

I recently stumbled upon a few examples that suggest patterns containing Alternatives do not evaluate for individual alternatives. For example: ...
3
votes
2answers
76 views

Except[] with levelspec

I am trying to determine all the variables used in list. For This I use: DeleteDuplicates[Cases[l1,_Symbol,-1]] This is great except that ...
12
votes
2answers
287 views

why MatchQ is fast and Replace slow?

Consider a large expression, say a polynomial with 25 terms expr=Product[Unique["a"],{i,1,25}]; to which you apply the following replacement rule: ...
1
vote
0answers
91 views

Need help interpreting a small block of code [closed]

I have recently "inherited" some Mathematica scripts which I need to interpret to write in some other languages (Maple and C++). I have never used Mathematica before so I have been learning on the ...
3
votes
1answer
118 views

The basic primitive recursive functions

How can the basic primitive recursive functions be expressed in the Wolfram Language? Apparently here's an example for primitive recursion: ...
20
votes
3answers
577 views

Detecting components in timeseries

I'm looking at this sequence of values: I'd like to detect the points where the center of the time-series shifts (around x=1000 and x=2000). Many of the transforms and smoothing methods I have ...
22
votes
4answers
332 views

Is there a GraphicsPrimitiveQ (or a complete list of Heads of graphics primitives)?

For various reasons related to workflow associated with creating figures for journals, I am creating functions that will accept graphics primitives and a set of options and spit out a ...
8
votes
2answers
120 views

Why is a longer pattern matched rather than a short pattern?

I was reading the Mathematica V5 Book and am a bit perplexed on the behavior of a particular pattern matching example where it seems to be choosing a longer pattern rather than a shorter pattern. The ...
4
votes
2answers
57 views

Is it possible to match a sequence with multiple heads without using Condition

Suppose I have: expr = Times[2, a[x,r], a[y,1], c[z,0,0], d[w,m]]; If I want to match a sequence of expressions with the same head ...
3
votes
1answer
64 views

How to collect elements in one list with the constraints provided in a second list

I wish to collect the items in the first list provided the constraints in the second list. For example in the lists shown below the first list shows a bunch of strings and the second list shows the ...
15
votes
3answers
420 views

Highlighting pattern strings in a large text

I would like to apply Style to strings that are matched, for example, with one or more specified patterns or regular expressions, a string or a list of both, ...
4
votes
2answers
151 views

What kind of pattern should be used

I was trying to make a simple question but made it trivial. So the original setting is as follows: expr = {{a}, b, {{c}, {e}}, d, {}} I need that all lists are ...
3
votes
1answer
80 views

How to prevent fractions in polynomial quotients?

(This was a hard question to give a succinct title to, so feel free to edit it.) When I divide polynomials, I would like Mathematica to NOT create negative powers of variables. For example: ...
1
vote
1answer
50 views

Pattern that matches numbers in the $\epsilon$-neighborhood of a given number?

I dfined the following function to create a pattern that matches the $\epsilon$-neighborhood of a given number. ep[x_, e_] := _?(x - e <= # <= x + e &) ...
2
votes
2answers
58 views

Remove an element of a list [duplicate]

I want to check if any element of a list contains Missing["NotAvailable"] If so I want to delete the entire list. If I am correct I need to have some ...
54
votes
10answers
2k views

Injecting a sequence of expressions into a held expression

Consider the following toy example: Hold[{1, 2, x}] /. x -> Sequence[3, 4] It will give Hold[{1, 2, Sequence[3, 4]}] ...
1
vote
0answers
54 views

Pattern placeholder for zero or more matching items in list [closed]

I'm working through the exercises in Stephen Wolfram's book "An Elementary Introduction to the Wolfram Language." In Chapter 32 on "Patterns", Exercise 32.1 is "Find lists beginning with 1 and ending ...
5
votes
2answers
150 views

How to name a repeated pattern sequence inside Plus?

Here is a sample expression that contains a bunch of f and some other stuff: ...
11
votes
2answers
191 views

Optional throws error when called from a package. Workaround?

Bug introduced in 8.0 or earlier and persisting through 10.3 or later. Case number: 305932. In the front-end notebook (Mathematica 9.0 and 10.2): ...
5
votes
2answers
163 views

Why this upvalue doesn't escape from Sum?

Probably a hard question, but I decide to cry out loud :). This is actually another problem I encountered when answering this question. Consider the following transform rule stored as an upvalue: ...
7
votes
4answers
99 views

Problem with handling a factor of $1$ in pattern matching

I am trying to implement the creation and annihilation operators $\hat{a}$ and $\hat{a}^{\dagger}$ of quantum mechanics with the following code, but alas, there is a problem with the pattern matching ...
4
votes
2answers
84 views

How can I extract something from an expression and assign it without changing the expression?

I am researching how to extract a certain value from an expression by using a pattern mechanism without actually changing the original expression. The paragraph above could be very ambiguous, so here ...
2
votes
1answer
71 views
3
votes
1answer
84 views

How to use patterns to return non-overlapping sequences of consecutive elements from an array

Let me first describe the data structure I'm looking at before describing my question. I have an array of nx3 elements with a data-generating process such that each row has the format: {previous ...
3
votes
1answer
87 views

How to use `Shortest` for pattern matching? [duplicate]

For the string ((!@#)), the shortest match for the pattern "("~~__~~")" should be "(!@#)", ...
8
votes
1answer
140 views

How to take all sub-strings in a string that are combinations of specified characters only

"tgtaaaaacaagaaaaacatggaatgtataatactataaataaaaaaagtaggaagaagaaccaaaaca\ aagggcgttttaaagagagacgaat" based on the above string (a DNA sequence) I wish to extract ...
2
votes
1answer
125 views

Pattern condition involving multiple arguments to a function

I can define conditions on individual arguments to a function: f[a_List/;condition(a),b_List/;condition(b)]:=(...) I am wondering if there is a way of declaring ...
3
votes
1answer
88 views

How to inject segments of code into functions defined by SetDelayed [duplicate]

I need to define a set of functions that are written in terms of common but lengthy expressions. To effect this, I want to inject abbreviations for such expressions into the RHS of ...
3
votes
1answer
55 views

MatchQ’ing Except[…] and Except[…]

A PostScriptForm1 for Mathematica must recurse over the likes of Plus[…]. Output should be as follows: 9+n: either ...
1
vote
1answer
43 views

Pattern matching for product of two terms fails if one factor is 1

I have a long set of replacement rules that I utilize to solve some longish integrals over trigonometric functions. Just look at this snippet (from this answer): ...
2
votes
1answer
34 views

Evaluation of BlankNullSequence inside StringReplace

I would like to replace the occurrence of "a(x)" and "b(x)" in a list with "a(x-na)" and ...
19
votes
2answers
359 views

What does f_[whoCalled]^:=f really mean?

I came across the following post by John Doty in this Google Groups discussion: On Friday, January 11, 2013 8:23:16 PM UTC-7, amzoti wrote: It is clear the Mathematica uses Lisp as one ...